PTER-phosphotriesterase related Gene View larger

PTER-phosphotriesterase related Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTER-phosphotriesterase related Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTER-phosphotriesterase related Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015092
Product type: DNA & cDNA
Ncbi symbol: PTER
Origin species: Human
Product name: PTER-phosphotriesterase related Gene
Size: 2ug
Accessions: BC015092
Gene id: 9317
Gene description: phosphotriesterase related
Synonyms: HPHRP; RPR-1; phosphotriesterase-related protein; parathion hydrolase-related protein; resiniferatoxin-binding, phosphotriesterase-related
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttccttaagtggaaaagtccaaaccgttttgggccttgtagagccaagcaaactgggccgtaccctgacccatgaacacctggccatgacctttgactgctgttactgtccacctcccccgtgccaggaagctatttccaaagaacctatcgtgatgaaaaatttatattggattcagaaaaacgcctattcccataaagaaaaccttcaattaaatcaggagacagaagccataaaggaagaactgttgtattttaaagctaatggtggaggggctttggtggaaaacacaaccactgggattagccgagacacacagacgttgaagaggcttgcagaagagactggcgtccatatcatatctggagccgggttttatgtggatgcaactcactcctcagagaccagggccatgtcagtggagcagcttaccgatgtccttatgaatgaaattctccatggagctgatggaaccagtatcaagtgtggcattattggagaaattggttgctcctggcctttgactgagagtgaaagaaaggttctccaggccacagctcatgcccaggctcagcttggttgtcctgttattatccatcctggacggagctccagggcaccatttcagattatccgaatattgcaagaagcaggcgcagacatctccaaaacagtcatgtcacacctggataggactattcttgataagaaagagctcttggagtttgctcaacttggctgctacttggaatatgatctctttggtactgaactacttcattaccaactcggcccagatattgacatgcctgatgataacaaaagaattagaagggtgcgtctcctggtggaagagggctgtgaagatcgaattctggtagcacatgacatacatacgaaaacccggctgatgaaatatggaggtcacggctattctcatatactcaccaatgttgttcctaaaatgttgctgagaggcataactgagaatgtgcttgataagattctaatagagaaccctaagcaatggctaactttcaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acid phosphatase, prostate
- T-cell leukemia homeobox 2
- NMDA receptor regulated 2
- TAP binding protein-like

Buy PTER-phosphotriesterase related Gene now

Add to cart