Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C4orf16-chromosome 4 open reading frame 16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C4orf16-chromosome 4 open reading frame 16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009485 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C4orf16 |
| Origin species: | Human |
| Product name: | C4orf16-chromosome 4 open reading frame 16 Gene |
| Size: | 2ug |
| Accessions: | BC009485 |
| Gene id: | 55435 |
| Gene description: | chromosome 4 open reading frame 16 |
| Synonyms: | C4orf16; 2C18; GBAR; PRO0971; gamma-BAR; AP-1 complex-associated regulatory protein; adapter-related protein complex 1-associated regulatory protein; gadkin; gamma-1-adaptin brefeldin A resistance protein; gamma-A1-adaptin and kinesin interactor; gamma1-adaptin brefeldin A resistance protein, gamma-BAR; adaptor related protein complex 1 associated regulatory protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaactgctgctggacgcagtgcttcggactgcttcgcaaggaagcggggcggctgcagcgagtaggcggcggcggaggatccaagtattttagaacatgctcaagaggtgagcacttaacaatagagtttgagaatctagtagaaagtgatgaaggggagagcccaggaagcagtcataggcctcttactgaggaagaaattgttgacctaagagaaaggcattatgattccattgccgaaaaacaaaaagatcttgataagaaaattcaaaaagagcaagaaaggcagagaattgtgcagcaatatcatccttccaacaatggagaatatcaaagttcaggaccagaagatgacttcgaatcttgtttgagaaatatgaagtcacagtatgaagtttttcgaagtagtagactctcatcagatgctacagttttgacaccaaatacagaaagcagttgtgatttaatgaccaaaactaaatcaactagtggaaatgacgacagcacatccttagatctagagtgggaagatgaagaaggaatgaatagaatgcttccaatgagagaacgttccaaaacagaggaagacattctacgggcagcacttaagtatagcaacaaggagactggaagtaatcctacatcagcctctgatgattccaatgggctggagtgggaaaatgattttgttagtgccgaaatggatgataatggaaattccgagtattctggatttgtaaatcctgtattagaactgtctgattctggcataaggcattctgacacagatcaacagactcgatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vascular endothelial growth factor B - mesoderm posterior 1 homolog (mouse) - chromosome 19 open reading frame 6 - TNFRSF1A-associated via death domain |