VEGFB-vascular endothelial growth factor B Gene View larger

VEGFB-vascular endothelial growth factor B Gene

PTXBC008818

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VEGFB-vascular endothelial growth factor B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VEGFB-vascular endothelial growth factor B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008818
Product type: DNA & cDNA
Ncbi symbol: VEGFB
Origin species: Human
Product name: VEGFB-vascular endothelial growth factor B Gene
Size: 2ug
Accessions: BC008818
Gene id: 7423
Gene description: vascular endothelial growth factor B
Synonyms: VEGFL; VRF; vascular endothelial growth factor B; VEGF-related factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccctctgctccgccgcctgctgctcgccgcactcctgcagctggcccccgcccaggcccctgtctcccagcctgatgcccctggccaccagaggaaagtggtgtcatggatagatgtgtatactcgcgctacctgccagccccgggaggtggtggtgcccttgactgtggagctcatgggcaccgtggccaaacagctggtgcccagctgcgtgactgtgcagcgctgtggtggctgctgccctgacgatggcctggagtgtgtgcccactgggcagcaccaagtccggatgcagatcctcatgatccggtacccgagcagtcagctgggggagatgtccctggaagaacacagccagtgtgaatgcagacctaaaaaaaaggacagtgctgtgaagccagacagggctgccactccccaccaccgtccccagccccgttctgttccgggctgggactctgcccccggagcaccctccccagctgacatcacccatcccactccagccccaggcccctctgcccacgctgcacccagcaccaccagcgccctgacccccggacctgccgctgccgctgccgacgccgcagcttcctccgttgccaagggcggggcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mesoderm posterior 1 homolog (mouse)
- chromosome 19 open reading frame 6
- TNFRSF1A-associated via death domain
- superoxide dismutase 2, mitochondrial

Buy VEGFB-vascular endothelial growth factor B Gene now

Add to cart