Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of KIRREL2-kin of IRRE like 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIRREL2-kin of IRRE like 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007312 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIRREL2 |
| Origin species: | Human |
| Product name: | KIRREL2-kin of IRRE like 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC007312 |
| Gene id: | 84063 |
| Gene description: | kin of IRRE like 2 (Drosophila) |
| Synonyms: | FILTRIN; NEPH3; NLG1; kin of IRRE-like protein 2; kin of irregular chiasm-like protein 2; nephrin-like gene 1; nephrin-like protein 3; kin of IRRE like 2 (Drosophila) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcaggatgcgggtccccgccctcctcgtcctcctcttctgcttcagagggagagcaggcccgtcgccccatttcctgcaacagccagaggacctggtggtgctgctgggcgagggaggtgcccaggccagcctgggccgtagagcctcagcctctttctccgagcaaaagaacctgatgcgaatccctggcagcagcgacggctccagttcacgaggtcctgaagaagaggagacaggcagccgcgaggaccggggccccattgtgcacactgaccacagtgatctggttctggaggaggaagggactctggagaccaaggacccaaccaacggttactacaaggtccgaggagtcagtgtgagcctgagccttggcgaagcccctggaggaggtctcttcctgccaccaccctccccccttgggcccccagggacccctaccttctatgacttcaacccacacctgggcatggtccccccctgcagactttacagagccagggcaggctatctcaccacaccccaccctcgagctttcaccagctacatcaaacccacatcctttgggcccccagatctggcccccgggactccccccttcccatatgctgccttccccacacctagccacccgcgtctccagactcacgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB32, member RAS oncogene family - Der1-like domain family, member 2 - mercaptopyruvate sulfurtransferase - FK506 binding protein 14, 22 kDa |