Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RNASEH2A-ribonuclease H2, subunit A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNASEH2A-ribonuclease H2, subunit A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011748 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNASEH2A |
| Origin species: | Human |
| Product name: | RNASEH2A-ribonuclease H2, subunit A Gene |
| Size: | 2ug |
| Accessions: | BC011748 |
| Gene id: | 10535 |
| Gene description: | ribonuclease H2, subunit A |
| Synonyms: | AGS4; JUNB; RNASEHI; RNHIA; RNHL; ribonuclease H2 subunit A; RNase H(35); RNase H2 subunit A; RNase HI large subunit; aicardi-Goutieres syndrome 4 protein; ribonuclease H2, large subunit; ribonuclease HI large subunit; ribonuclease HI subunit A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatctcagcgagctggagagagacaatacaggccgctgtcgcctgagttcgcctgtgcccgcggtgtgccgcaaggagccttgcgtcctgggcgtcgatgaggcgggcaggggccccgtgctgggccccatggtctacgccatctgttattgtcccctgcctcgcctggcagatctggaggcgctgaaagtggcagactcaaagaccctattggagagcgagcgggaaaggctgtttgcgaaaatggaggacacggactttgtcggctgggcgctggatgtgctgtctccaaacctcatctctaccagcatgcttgggcgggtcaaatacaacctgaactccctgtcacatgatacagccactgggcttatacagtatgcattggaccagggcgtgaacgtcacccaggtattcgtggacaccgtagggatgccagagacataccaggcgcggctgcagcaaagttttcccgggattgaggtgacggtcaaggccaaagcagatgccctctacccggtggttagtgctgccagcatctgtgccaaggtggcccgggaccaggccgtgaagaaatggcagttcgtggagaaactgcaggacttggatactgattatggctcaggctaccccaatgatcccaagacaaaagcgtggttgaaggagcacgtggagcctgtgttcggcttcccccagtttgtccggttcagctggcgcacggcccagaccatcctggagaaagaggcggaagatgttatatgggaggactcagcatccgagaatcaggagggactcaggaagatcacatcctacttcctcaatgaagggtcccaagcccgtccccgttcttcccaccgatatttcctggaacgcggcctggagtcagcaaccagcctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DKFZP564O0823 protein - sarcoma antigen NY-SAR-48 - programmed cell death 2-like - transmembrane protein 170A |