Login to display prices
Login to display prices
TMEM170A-transmembrane protein 170A Gene View larger

TMEM170A-transmembrane protein 170A Gene

PTXBC018082

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM170A-transmembrane protein 170A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM170A-transmembrane protein 170A Gene

Proteogenix catalog: PTXBC018082
Ncbi symbol: TMEM170A
Product name: TMEM170A-transmembrane protein 170A Gene
Size: 2ug
Accessions: BC018082
Gene id: 124491
Gene description: transmembrane protein 170A
Synonyms: TMEM170; transmembrane protein 170A; transmembrane protein 170
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgcgaggggagcggcggcagcggcgggtcggccgggctcctgcagcagatcctgagcctgaaggttgtgccgcgggtgggcaacgggaccctgtgccccaactctacttccctctgctccttcccagagatgtggtatggtgtattcctgtgggcactggtgtcttctctcttctttcatgtccctgctggattactggccctcttcaccctcagacatcacaaatatggtaggttcatgtctgtaagcatcctgttgatgggcatcgtgggaccaattactgctggaatcttgacaagtgcagctattgctggagtttaccgagcagcagggaaggaaatgataccatttgaagccctcacactgggcactggacagacattttgcgtcttggtggtctcctttttacggattttagctactctatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: