TMEM170A-transmembrane protein 170A Gene View larger

TMEM170A-transmembrane protein 170A Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM170A-transmembrane protein 170A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM170A-transmembrane protein 170A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018082
Product type: DNA & cDNA
Ncbi symbol: TMEM170A
Origin species: Human
Product name: TMEM170A-transmembrane protein 170A Gene
Size: 2ug
Accessions: BC018082
Gene id: 124491
Gene description: transmembrane protein 170A
Synonyms: TMEM170; transmembrane protein 170A; transmembrane protein 170
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgcgaggggagcggcggcagcggcgggtcggccgggctcctgcagcagatcctgagcctgaaggttgtgccgcgggtgggcaacgggaccctgtgccccaactctacttccctctgctccttcccagagatgtggtatggtgtattcctgtgggcactggtgtcttctctcttctttcatgtccctgctggattactggccctcttcaccctcagacatcacaaatatggtaggttcatgtctgtaagcatcctgttgatgggcatcgtgggaccaattactgctggaatcttgacaagtgcagctattgctggagtttaccgagcagcagggaaggaaatgataccatttgaagccctcacactgggcactggacagacattttgcgtcttggtggtctcctttttacggattttagctactctatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - selenophosphate synthetase 2
- transmembrane protein 106C
- RAD18 homolog (S. cerevisiae)
- BUD13 homolog (S. cerevisiae)

Buy TMEM170A-transmembrane protein 170A Gene now

Add to cart