Cart 1 Product Products 201,40 € (empty)
-
1 x KOMBITEST™...201,40 €
No products
To be determined Shipping
201,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 201,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 201,40 €
View larger 
Data sheet of TP53I3-tumor protein p53 inducible protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TP53I3-tumor protein p53 inducible protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000474 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TP53I3 |
| Origin species: | Human |
| Product name: | TP53I3-tumor protein p53 inducible protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC000474 |
| Gene id: | 9540 |
| Gene description: | tumor protein p53 inducible protein 3 |
| Synonyms: | quinone oxidoreductase PIG3; p53-induced gene 3 protein; quinone oxidoreductase homolog; tumor protein p53 inducible protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttagccgtgcactttgacaagccgggaggaccggaaaacctctacgtgaaggaggtggccaagccgagcccgggggagggtgaagtcctcctgaaggtggcggccagcgccctgaaccgggcggacttaatgcagagacaaggccagtatgacccacctccaggagccagcaacattttgggacttgaggcatctggacatgtggcagagctggggcctggctgccagggacactggaagatcggggacacagccatggctctgctccccggtgggggccaggctcagtacgtcactgtccccgaagggctcctcatgcctatcccagagggattgaccctgacccaggctgcagccatcccagaggcctggctcaccgccttccagctgttacatcttgtgggaaatgttcaggctggagactatgtgctaatccatgcaggactgagtggtgtgggcacagctgctatccaactcacccggatggctggagctattcctctggtcacagctggctcccagaagaagcttcaaatggcagaaaagcttggagcagctgctggattcaattacaaaaaagaggatttctctgaagcaacgctgaaattcaccaaaggtgctggagttaatcttattctagactgcataggcggatcctactgggagaagaacgtcaactgcctggctcttgatggtcgatgggttctctatggtctgatgggaggaggtgacatcaatgggcccctgttttcaaagctactttttaagcgaggaagtctgatcaccagtttgctgaggtctagggacaataagtacaagcaaatgctggtgaatgctttcacggagcaaattctgcctcacttctccacggagggcccccaacgtctgctgccggttctggacagaatctacccagtgaccgaaatccaggaggcccataagtacatggaggccaacaagaacataggcaagatcgtcctggaactgccccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - golgi phosphoprotein 3 (coat-protein) - chemokine (C-C motif) ligand 3-like 3 - chromosome 12 open reading frame 43 - chromosome 16 open reading frame 13 |