Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CCL3L3-chemokine (C-C motif) ligand 3-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL3L3-chemokine (C-C motif) ligand 3-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007783 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL3L3 |
| Origin species: | Human |
| Product name: | CCL3L3-chemokine (C-C motif) ligand 3-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC007783 |
| Gene id: | 414062 |
| Gene description: | chemokine (C-C motif) ligand 3-like 3 |
| Synonyms: | D17S1718; G0S19-2; LD78; LD78BETA; SCYA3L; SCYA3L1; C-C motif chemokine 3-like 1; G0/G1 switch regulatory protein 19-2; LD78-beta(1-70); chemokine (C-C motif) ligand 3-like 3; chemokine (C-C motif) ligand 3-like, centromeric; small inducible cytokine A3-like 1; tonsillar lymphocyte LD78 beta protein; C-C motif chemokine ligand 3 like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggtctccactgctgcccttgccgtcctcctctgcaccatggctctctgcaaccaggtcctctctgcaccacttgctgctgacacgccgaccgcctgctgcttcagctacacctcccggcagattccacagaatttcatagctgactactttgagacgagcagccagtgctccaagcccagtgtcatcttcctaaccaagagaggccggcaggtctgtgctgaccccagtgaggagtgggtccagaaatacgtcagtgacctggagccgagtgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 12 open reading frame 43 - chromosome 16 open reading frame 13 - chromosome 21 open reading frame 56 - mitochondrial ribosomal protein S18A |