Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 973,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 973,00 €
Data sheet of SPIN3-spindlin family, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPIN3-spindlin family, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032490 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPIN3 |
| Origin species: | Human |
| Product name: | SPIN3-spindlin family, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC032490 |
| Gene id: | 169981 |
| Gene description: | spindlin family, member 3 |
| Synonyms: | SPIN-3; TDRD27; bA445O16.1; spindlin-3; bA445O16.1 (DXF34); spindlin-like protein 3; spindlin family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaccccgtttggaaaggcagctgcagggcagcggtccaggacgggcgctggccacggcagtgtgtctgttaccatgataaagaggaaggctgcacacaagaagcataggagccgacccacctcccagcctcgggggaacatcgtgggctgcagaattcagcacggatggaaagatggagatgaacctctaacacagtggaaaggaaccgttctggatcagctcctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - T-cell leukemia homeobox 3 - transmembrane protein 62 - mediator complex subunit 6 - PIH1 domain containing 2 |