Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SCN2B-sodium channel, voltage-gated, type II, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCN2B-sodium channel, voltage-gated, type II, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036793 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCN2B |
| Origin species: | Human |
| Product name: | SCN2B-sodium channel, voltage-gated, type II, beta Gene |
| Size: | 2ug |
| Accessions: | BC036793 |
| Gene id: | 6327 |
| Gene description: | sodium channel, voltage-gated, type II, beta |
| Synonyms: | ATFB14; sodium channel subunit beta-2; neuronal voltage-gated sodium channel beta 2 subunit; sodium channel, voltage gated, type II beta subunit; sodium channel, voltage-gated, type II, beta polypeptide; sodium voltage-gated channel beta subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacagagatgcctggctacctcgccctgccttcagcctcacggggctcagtctctttttctctttggtgccaccaggacggagcatggaggtcacagtacctgccaccctcaacgtcctcaatggctctgacgcccgcctgccctgcaccttcaactcctgctacacagtgaaccacaaacagttctccctgaactggacttaccaggagtgcaacaactgctctgaggagatgttcctccagttccgcatgaagatcattaacctgaagctggagcggtttcaagaccgcgtggagttctcagggaaccccagcaagtacgatgtgtcggtgatgctgagaaacgtgcagccggaggatgaggggatttacaactgctacatcatgaacccccctgaccgccaccgtggccatggcaagatccatctgcaggtcctcatggaagagccccctgagcgggactccacggtggccgtgattgtgggtgcctccgtcgggggcttcctggctgtggtcatcttggtgctgatggtggtcaagtgtgtgaggagaaaaaaagagcagaagctgagcacagatgacctgaagaccgaggaggagggcaagacggacggtgaaggcaacccggatgatggcgccaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - arginine-rich, mutated in early stage tumors - xeroderma pigmentosum, complementation group A - small nuclear ribonucleoprotein 40kDa (U5) - major histocompatibility complex, class I, C |