Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of XPA-xeroderma pigmentosum, complementation group A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about XPA-xeroderma pigmentosum, complementation group A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014965 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | XPA |
| Origin species: | Human |
| Product name: | XPA-xeroderma pigmentosum, complementation group A Gene |
| Size: | 2ug |
| Accessions: | BC014965 |
| Gene id: | 7507 |
| Gene description: | xeroderma pigmentosum, complementation group A |
| Synonyms: | XPA, DNA damage recognition and repair factor; XP1; XPAC; DNA repair protein complementing XP-A cells; excision repair-controlling; mutant xeroderma pigmentosum complementation group A; xeroderma pigmentosum group A-complementing protein; xeroderma pigmentosum, complementation group A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggccgacggggctttgccggaggcggcggctttagagcaacccgcggagctgcctgcctcggtgcgggcgagtatcgagcggaagcggcagcgggcactgatgctgcgccaggcccggctggctgcccggccctactcggcgacggcggctgcggctactggaggcatggctaatgtaaaagcagccccaaagataattgacacaggaggaggcttcattttagaagaggaagaagaagaagaacagaaaattggaaaagttgttcatcaaccaggacctgttatggaatttgattatgtaatatgcgaagaatgtgggaaagaatttatggattcttatcttatgaaccactttgatttgccaacttgtgataactgcagagatgctgatgataaacacaagcttataaccaaaacagaggcaaaacaagaatatcttctgaaagactgtgatttagaaaaaagagagccacctcttaaatttattgtgaagaagaatccacatcattcacaatggggtgatatgaaactctacttaaagttacagattgtgaagaggtctcttgaagtttggggtagtcaagaagcattagaagaagcaaaggaagtccgacaggaaaaccgagaaaaaatgaaacagaagaaatttgataaaaaagtaaaagaattgcggcgagcagtaagaagcagcgtgtggaaaagggagacgattgttcatcaacatgagtatggaccagaagaaaacctagaagatgacatgtaccgtaagacttgtactatgtgtggccatgaactgacatatgaaaaaatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - small nuclear ribonucleoprotein 40kDa (U5) - major histocompatibility complex, class I, C - similar to hypothetical protein MGC27019 - golgi transport 1 homolog B (S. cerevisiae) |