Cart 2 Product Products 482,40 € (empty)
-
-
1 x SPANXA1-sp...113,40 €
No products
To be determined Shipping
482,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 482,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 482,40 €
View larger 
SLC39A1-solute carrier family 39 (zinc transporter), member 1 Gene
PTXBC002563
New product
Data sheet of SLC39A1-solute carrier family 39 (zinc transporter), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC39A1-solute carrier family 39 (zinc transporter), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002563 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC39A1 |
| Origin species: | Human |
| Product name: | SLC39A1-solute carrier family 39 (zinc transporter), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC002563 |
| Gene id: | 27173 |
| Gene description: | solute carrier family 39 (zinc transporter), member 1 |
| Synonyms: | ZIP1; ZIRTL; zinc transporter ZIP1; solute carrier family 39 (zinc transporter), member 1; solute carrier family 39 (zinc transporter), member 3; zrt- and Irt-like protein 1; solute carrier family 39 member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggccctggggagagccagagctcctggtgtggcgccccgaggcggtagcttcagagcctccagtgcctgtggggctggaggtgaagttgggggccctggtgctgctgctggtgctcaccctcctctgcagcctggtgcccatctgtgtgctgcgccggccaggagctaaccatgaaggctcagcttcccgccagaaagccctgagcctagtaagctgtttcgcggggggcgtctttttggccacttgtctcctggacctgctgcctgactacctggctgccatagatgaggccctggcagccttgcacgtgacgctccagttcccactgcaagagttcatcctggccatgggcttcttcctggtcctggtgatggagcagatcacactggcttacaaggagcagtcagggccgtcacctctggaggaaacaagggctctgctgggaacagtgaatggtgggccgcagcattggcatgatgggccaggggtcccacaggcgagtggagccccagcaaccccctcagccttgcgtgcctgtgtactggtgttctccctggccctccactccgtgttcgaggggctggcggtagggctgcagcgagaccgggctcgggccatggagctgtgcctggctttgctgctccacaagggcatcctggctgtcagcctgtccctgcggctgttgcagagccaccttagggcacaggtggtggctggctgtgggatcctcttctcatgcatgacacctctaggcatcgggctgggtgcagctctggcagagtcggcaggacctctgcaccagctggcccagtctgtgctagagggcatggcagctggcacctttctctatatcacctttctggaaatcctgccccaggagctggccagttctgagcaaaggatcctcaaggtcattctgctcctagcaggctttgccctgctcactggcctgctcttcatccaaatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 39 (zinc transporter), member 3 - dehydrogenase E1 and transketolase domain containing 1 - general transcription factor IIF, polypeptide 1, 74kDa - potassium channel tetramerisation domain containing 15 |