Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CACNA2D4-calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene
PTXBC048288
New product
Data sheet of CACNA2D4-calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CACNA2D4-calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC048288 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CACNA2D4 |
| Origin species: | Human |
| Product name: | CACNA2D4-calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene |
| Size: | 2ug |
| Accessions: | BC048288 |
| Gene id: | 93589 |
| Gene description: | calcium channel, voltage-dependent, alpha 2/delta subunit 4 |
| Synonyms: | RCD4; voltage-dependent calcium channel subunit alpha-2/delta-4; calcium channel, voltage-dependent, alpha 2/delta subunit 4; voltage-gated calcium channel alpha(2)delta-4 subunit; voltage-gated calcium channel subunit alpha-2/delta-4; calcium voltage-gated channel auxiliary subunit alpha2delta 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtatgactatcaggccatgtgcaaaccctcgagtcaccaccacagtgcagcccagcccctggtcagcccaatttctgccttcttgacggcgaccaggtggctgctgcaggagctggtgctgttcctgctggagtggagtgtctggggctcctggtacgacagaggggccgaggccaaaagtgtcttccatcactcccacaaacacaagaagcaggacccgctgcagccctgcgacacggagtaccccgtgttcgtgtaccagccggccatccgggaggccaacgggatcgtggagtgcgggccctgccagaaggtatttgtggtgcagcagattcccaacagtaacctcctcctcctggtgacagaccccacctgtgactgcagcatcttcccaccagtgctgcaggaggcgacagaagtcaaatataatgcctctgtcaaatgtgaccggatgcgctcccagaagctccgccggcgaccagactcctgccacgccttccatccagaggagaatgcccaggactgcggcggcgcctcggacacctcagcctcgccgcccctactcctgctgcctgtgtgtgcctgggggctactgccccaactcctgcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) - fibroblast growth factor (acidic) intracellular binding protein - ribonuclease, RNase A family, 3 (eosinophil cationic protein) - obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF |