No products
Prices are tax excluded
PTXBC098262
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC098262 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OBSCN |
| Origin species: | Human |
| Product name: | OBSCN-obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF Gene |
| Size: | 2ug |
| Accessions: | BC098262 |
| Gene id: | 84033 |
| Gene description: | obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF |
| Synonyms: | ARHGEF30; UNC89; obscurin; obscurin, myosin light chain kinase; obscurin-MLCK; obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcactgcacagtggatggagaaactgtgattcttgtgctgggaggtggtggggcttctcccagctacatggccagtgccaagcttgggaaggttctgtttctcctactttctcgtctaggccctcctaccctagggtggtcttcctgacctgggcagtatctttgacctcgtgtgtccctccttgtccatccccagagcccaaggtggtgtttgccaaggagcagccagcacacagggaggtgcaggctgaggcgggggccagtgccacgctgagctgcgaggtggcccaggcccagacagaggtgacgtggtacaaggatgggaagaagctgagttccagctcgaaagtgcgcgtggaggccgtgggctgcacacggaggctggtggtgcagcaggcgggccaggcagaggccggggagtacagctgcgaggcagggggtcagcagctctccttccgcctgcaggtggcaggtcagtgctttggggatgctgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 11 - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 - protein phosphatase 2C, magnesium-dependent, catalytic subunit - ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) |