Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PRAC-prostate cancer susceptibility candidate Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRAC-prostate cancer susceptibility candidate Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030950 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRAC |
| Origin species: | Human |
| Product name: | PRAC-prostate cancer susceptibility candidate Gene |
| Size: | 2ug |
| Accessions: | BC030950 |
| Gene id: | 84366 |
| Gene description: | prostate cancer susceptibility candidate |
| Synonyms: | small nuclear protein PRAC; PRAC; C17orf92; small nuclear protein PRAC1; prostate cancer susceptibility candidate protein 1; prostate, rectum and colon expressed gene protein; prostate cancer susceptibility candidate 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgtgcgcccatttctcagatcaaggaccggcccatcttactacctccaagagtgcttttctctctaataagaaaacatctactttgaaacatctactgggcgagaccaggagtgatggctcagcctgtaattctggaatttcgggaggccgaggcaggaagattccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 - transmembrane and coiled-coil domains 4 - secreted LY6/PLAUR domain containing 1 - NOL1/NOP2/Sun domain family, member 5C |