Cart 10 Product Products 1 400,79 € (empty)
-
1 x CNN1-calpo...121,50 € -
1 x CDC73-cell...121,50 € -
-
-
1 x RTP4-recep...113,40 € -
1 x ZNF843-zin...121,50 € -
1 x DNAJC24-Dn...113,40 € -
1 x MRPL36-mit...113,40 € -
1 x LEPROT-lep...113,40 € -
No products
To be determined Shipping
1 400,79 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 400,79 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 400,79 €
View larger 
CHST14-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 Gene
PTXBC049214
New product
Data sheet of CHST14-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHST14-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC049214 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHST14 |
| Origin species: | Human |
| Product name: | CHST14-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 Gene |
| Size: | 2ug |
| Accessions: | BC049214 |
| Gene id: | 113189 |
| Gene description: | carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 |
| Synonyms: | ATCS; D4ST1; EDSMC1; HNK1ST; carbohydrate sulfotransferase 14; carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14; carbohydrate (dermatan 4) sulfotransferase 14; dermatan 4 sulfotransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcccccgcccgctgaccccgctggcggccccaaatggcgccgagcccctgggccgggcgctgaggcgggcccctctgggcagggcccgggcggggctgggtgggccgcccctgctgctgccgtccatgctgatgtttgcggtgatcgtggcctccagcgggctgctgctcatgatcgagcggggcatcctggccgagatgaagcccctgcccctgcacccgcccggccgcgagggcacagcctggcgcgggaaagcccccaagcctgggggcctgtccctcagggctggggacgcggacttgcaagtgcggcaggacgtccggaacaggaccctgcgggcggtgtgcggacagccaggcatgccccgggacccctgggacttgccggtggggcagcggcgcaccctgctgcgccacatcctcgtaagtgaccgttaccgcttcctctactgctacgtccccaaggtggcctgctctaactggaagcgggtgatgaaggtgctggcaggcgtcctggacagcgtggacgtccgcctcaagatggaccaccgcagtgacctggtgttcctggccgacctgcggcctgaggagattcgctaccgcctgcagcactactttaagttcctgtttgtgcgggagcccttggaacgcctcctctctgcctaccgcaacaagtttggcgagatccgagagtaccagcaacgctatggggctgagatagtgaggcggtacagggctggagcggggcccagccctgcaggcgacgatgtcacattccccgagttcctgagatacctggtggatgaggaccctgagcgcatgaatgagcattggatgcccgtgtaccacctgtgccagccttgtgccgtgcactatgactttgtgggctcctatgagaggctggaggctgatgcaaatcaggtgctggagtgggtacgggcaccacctcacgtccgatttccagctcgccaggcctggtaccggccagccagccccgaaagcctgcattaccacttgtgcagtgccccccgggccctgctgcaggatgtgctgcctaagtatatcctggacttctccctctttgcctacccactgcctaatgtcaccaaggaggcgtgtcagcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2D N-terminal like pseudogene - solute carrier family 27 (fatty acid transporter), member 4 - transition protein 1 (during histone to protamine replacement) - glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) |