Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNP1-transition protein 1 (during histone to protamine replacement) Gene
PTXBC029516
New product
Data sheet of TNP1-transition protein 1 (during histone to protamine replacement) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNP1-transition protein 1 (during histone to protamine replacement) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029516 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNP1 |
| Origin species: | Human |
| Product name: | TNP1-transition protein 1 (during histone to protamine replacement) Gene |
| Size: | 2ug |
| Accessions: | BC029516 |
| Gene id: | 7141 |
| Gene description: | transition protein 1 (during histone to protamine replacement) |
| Synonyms: | TP1; spermatid nuclear transition protein 1; STP-1; TP-1; transition protein 1 (during histone to protamine replacement); transition protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgaccagccgcaaattaaagagtcatggcatgaggaggagcaagagccgatctcctcacaagggagtcaagagaggtggcagcaaaagaaaataccgtaagggcaacctgaaaagtaggaaacggggcgatgacgccaatcgcaattaccgctcccacttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) - potassium voltage-gated channel, KQT-like subfamily, member 5 - integrin, alpha M (complement component 3 receptor 3 subunit) - uveal autoantigen with coiled-coil domains and ankyrin repeats |