TNP1-transition protein 1 (during histone to protamine replacement) Gene View larger

TNP1-transition protein 1 (during histone to protamine replacement) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNP1-transition protein 1 (during histone to protamine replacement) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNP1-transition protein 1 (during histone to protamine replacement) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029516
Product type: DNA & cDNA
Ncbi symbol: TNP1
Origin species: Human
Product name: TNP1-transition protein 1 (during histone to protamine replacement) Gene
Size: 2ug
Accessions: BC029516
Gene id: 7141
Gene description: transition protein 1 (during histone to protamine replacement)
Synonyms: TP1; spermatid nuclear transition protein 1; STP-1; TP-1; transition protein 1 (during histone to protamine replacement); transition protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgaccagccgcaaattaaagagtcatggcatgaggaggagcaagagccgatctcctcacaagggagtcaagagaggtggcagcaaaagaaaataccgtaagggcaacctgaaaagtaggaaacggggcgatgacgccaatcgcaattaccgctcccacttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
- potassium voltage-gated channel, KQT-like subfamily, member 5
- integrin, alpha M (complement component 3 receptor 3 subunit)
- uveal autoantigen with coiled-coil domains and ankyrin repeats

Buy TNP1-transition protein 1 (during histone to protamine replacement) Gene now

Add to cart