Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNRPB-small nuclear ribonucleoprotein polypeptides B and B1 Gene
PTXBC080516
New product
Data sheet of SNRPB-small nuclear ribonucleoprotein polypeptides B and B1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRPB-small nuclear ribonucleoprotein polypeptides B and B1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC080516 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRPB |
| Origin species: | Human |
| Product name: | SNRPB-small nuclear ribonucleoprotein polypeptides B and B1 Gene |
| Size: | 2ug |
| Accessions: | BC080516 |
| Gene id: | 6628 |
| Gene description: | small nuclear ribonucleoprotein polypeptides B and B1 |
| Synonyms: | CCMS; COD; SNRPB1; Sm-B/B'; SmB/B'; SmB/SmB'; snRNP-B; small nuclear ribonucleoprotein-associated proteins B and B'; B polypeptide of Sm protein; Sm protein B/B'; sm-B/Sm-B'; small nuclear ribonucleoprotein polypeptide B; small nuclear ribonucleoprotein polypeptides B and B'; small nuclear ribonucleoprotein polypeptides B and B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggtgggcaagagcagcaagatgctgcagcatattgattacaggatgaggtgcatcctgcaggacggccggatcttcattggcaccttcaaggcttttgacaagcacatgaatttgatcctctgtgactgtgatgagttcagaaagatcaagccaaagaactccaaacaagcagaaagggaagagaagcgagtcctcggtctggtgctgctgcgaggggagaatctggtctcaatgacagtagagggacctcctcccaaagatactggtattgctcgagttccacttgctggagctgccgggggcccagggatcggcagggctgctggcagaggaatcccagctggggttcccatgccccaggctcctgcaggacttgctgggccagtccgtggggttggcgggccatcccaacaggtgatgaccccacaaggaagaggtactgttgcagccgctgcagctgctgccacagccagtattgccggggctccaacccagtacccacctggccgtgggggtcctcccccacctatgggccgaggagcaccccctccaggcatgatgggcccacctcctggtatgagacctcctatgggtcccccaatggggatcccccctggaagagggactccaatgggcatgccccctccgggaatgcggcctcctccccctgggatgcgaggccttctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - wingless-type MMTV integration site family, member 9B - intraflagellar transport 122 homolog (Chlamydomonas) - transmembrane and immunoglobulin domain containing 2 - Src homology 2 domain containing transforming protein D |