Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST2H2BE-histone cluster 2, H2be Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST2H2BE-histone cluster 2, H2be Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069193 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST2H2BE |
| Origin species: | Human |
| Product name: | HIST2H2BE-histone cluster 2, H2be Gene |
| Size: | 2ug |
| Accessions: | BC069193 |
| Gene id: | 8349 |
| Gene description: | histone cluster 2, H2be |
| Synonyms: | GL105; H2B; H2B.1; H2BFQ; H2BGL105; H2BQ; histone H2B type 2-E; H2B histone family, member Q; histone 2, H2be; histone H2B-GL105; histone H2B.q; histone cluster 2, H2be; histone cluster 2 H2B family member e |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgaaccggcaaaatccgctccggcccctaaaaagggctccaagaaagccgtcaccaaagcccagaagaaagacggcaagaagcgcaagcgcagccgcaaagagagctactccatctacgtgtacaaggtgctgaagcaggtccaccccgacaccggcatctcgtccaaggccatgggcatcatgaactccttcgtcaacgacatcttcgagcgcatcgcgggagaggcttcccgcctggcgcactacaacaagcgctccaccatcacatcccgcgagatccagacggccgtgcgcctgctgctgcccggcgagctggccaagcacgccgtgtccgagggcaccaaggcggtcaccaagtacaccagctccaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 107 - histone cluster 1, H2aa - ancient ubiquitous protein 1 - transmembrane protein 87A |