Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H2AA-histone cluster 1, H2aa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H2AA-histone cluster 1, H2aa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062211 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H2AA |
| Origin species: | Human |
| Product name: | HIST1H2AA-histone cluster 1, H2aa Gene |
| Size: | 2ug |
| Accessions: | BC062211 |
| Gene id: | 221613 |
| Gene description: | histone cluster 1, H2aa |
| Synonyms: | H2AA; H2AFR; TH2A; bA317E16.2; histone H2A type 1-A; H2A histone family, member R; histone 1, H2aa; histone H2A/r; histone cluster 1, H2aa; histone cluster 1 H2A family member a |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctggacgagggaagcagggaggaaaagcacgcgccaagtctaagtctcgctcttctagagcgggtttgcagtttcccgtaggccggatccatcgtctgcttcgtaagggaaactatgcagagcggataggggcaggcgcaccagtgtatttggcggcagtgttagagtatctcacagcagaaatccttgagctggcaggcaatgcgtctcgcgataacaaaaaaactcgcattattccccgccacctgcagctagcgatccgcaatgatgaggaactcaataagcttttgggcggcgtgaccattgcccagggcggagtcctgcctaacattcaggcagtgctgctgcccaagaagactgagagtcaccaccataaagcccaaagcaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ancient ubiquitous protein 1 - transmembrane protein 87A - transmembrane protein 116 - transmembrane protein 198 |