Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UTY-ubiquitously transcribed tetratricopeptide repeat gene, Y-linked Gene
PTXBC071744
New product
Data sheet of UTY-ubiquitously transcribed tetratricopeptide repeat gene, Y-linked Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UTY-ubiquitously transcribed tetratricopeptide repeat gene, Y-linked Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC071744 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UTY |
| Origin species: | Human |
| Product name: | UTY-ubiquitously transcribed tetratricopeptide repeat gene, Y-linked Gene |
| Size: | 2ug |
| Accessions: | BC071744 |
| Gene id: | 7404 |
| Gene description: | ubiquitously transcribed tetratricopeptide repeat gene, Y-linked |
| Synonyms: | ubiquitous TPR motif protein UTY; histone demethylase UTY; KDM6AL; KDM6C; UTY1; ubiquitously transcribed TPR gene on Y chromosome; ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome; ubiquitously transcribed tetratricopeptide repeat gene, Y-linked; ubiquitously-transcribed TPR protein on the Y chromosome; ubiquitously-transcribed Y chromosome tetratricopeptide repeat protein; ubiquitously transcribed tetratricopeptide repeat containing, Y-linked |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaatcgtgcgcagtgtcgctcactaccgccgctgttgccttcggtgatgaggcaaagaaaatggcggaaggaaaagcgagccgcgagagtgaagaggagtctgttagcctgacagtcgaggaaagggaggcgcttggtggcatggacagccgtctcttcgggttcgtgaggcttcatgaagatggcgccagaacgaagaccctactaggcaaggtaaaagcaaccagacgcaaagtctttggtccgcactttgctctaccaaggccccgcgttccttaccgcccagccagtatttattttggctctgctccatggccaaggggtcggaaaagtgtttcttgcctttgctgtccccgtactctggaatacttcgccccttgctccagactcccttctactctgaggaaaaaaaaaatcggacgctttgggaccgggctaaaccgggtctacaccacatgcctgttactttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 29 (nucleoside transporters), member 4 - phospholipase A2, group IVC (cytosolic, calcium-independent) - calcium channel, voltage-dependent, alpha 2/delta subunit 4 - Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) |