Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene
PTXBC051296
New product
Data sheet of IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC051296 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IGF2BP3 |
| Origin species: | Human |
| Product name: | IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC051296 |
| Gene id: | 10643 |
| Gene description: | insulin-like growth factor 2 mRNA binding protein 3 |
| Synonyms: | CT98; IMP-3; IMP3; KOC; KOC1; VICKZ3; insulin-like growth factor 2 mRNA-binding protein 3; IGF-II mRNA-binding protein 3; IGF2 mRNA-binding protein 3; KH domain containing protein overexpressed in cancer; VICKZ family member 3; cancer/testis antigen 98; insulin like growth factor 2 mRNA binding protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacaaactgtatatcggaaacctcagcgagaacgccgccccctcggacctagaaagtatcttcaaggacgccaagatcccggtgtcgggacccttcctggtgaagactggctacgcgttcgtggactgcccggacgagagctgggccctcaaggccatcgaggcgctttcaggtaaaatagaactgcacgggaaacccatagaagttgagcactcggtcccaaaaaggcaaaggattcggaaacttcagatacgaaatatcccgcctcatttacagtgggaggaaatggggcagccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor GTPase activating protein 1 - basic helix-loop-helix domain containing, class B, 2 - small nuclear ribonucleoprotein polypeptides B and B1 - wingless-type MMTV integration site family, member 9B |