IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene View larger

IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene

PTXBC051296

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051296
Product type: DNA & cDNA
Ncbi symbol: IGF2BP3
Origin species: Human
Product name: IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene
Size: 2ug
Accessions: BC051296
Gene id: 10643
Gene description: insulin-like growth factor 2 mRNA binding protein 3
Synonyms: CT98; IMP-3; IMP3; KOC; KOC1; VICKZ3; insulin-like growth factor 2 mRNA-binding protein 3; IGF-II mRNA-binding protein 3; IGF2 mRNA-binding protein 3; KH domain containing protein overexpressed in cancer; VICKZ family member 3; cancer/testis antigen 98; insulin like growth factor 2 mRNA binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaaactgtatatcggaaacctcagcgagaacgccgccccctcggacctagaaagtatcttcaaggacgccaagatcccggtgtcgggacccttcctggtgaagactggctacgcgttcgtggactgcccggacgagagctgggccctcaaggccatcgaggcgctttcaggtaaaatagaactgcacgggaaacccatagaagttgagcactcggtcccaaaaaggcaaaggattcggaaacttcagatacgaaatatcccgcctcatttacagtgggaggaaatggggcagccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor GTPase activating protein 1
- basic helix-loop-helix domain containing, class B, 2
- small nuclear ribonucleoprotein polypeptides B and B1
- wingless-type MMTV integration site family, member 9B

Buy IGF2BP3-insulin-like growth factor 2 mRNA binding protein 3 Gene now

Add to cart