C6orf58-chromosome 6 open reading frame 58 Gene View larger

C6orf58-chromosome 6 open reading frame 58 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf58-chromosome 6 open reading frame 58 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf58-chromosome 6 open reading frame 58 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC062712
Product type: DNA & cDNA
Ncbi symbol: C6orf58
Origin species: Human
Product name: C6orf58-chromosome 6 open reading frame 58 Gene
Size: 2ug
Accessions: BC062712
Gene id: 352999
Gene description: chromosome 6 open reading frame 58
Synonyms: UPF0762 protein C6orf58; LEG1; protein LEG1 homolog; liver enriched gene 1 homolog; chromosome 6 open reading frame 58
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggatgtataaaatcatattgaatcagacagccaggtattttgcaaaatttgcaccagataatgaacagaatattttatgggggttgcctctgcagtatggctggcaatataggacaggcagattagctgatccaacccgaaggacaaactgtggctatgaatctggagatcatatgtgcatctctgtggacagttggtgggctgatttgaattattttctgtcttcattaccctttcttgctgcggttgattctggtgtaatggggatatcatcagaccaagtcaggcttttgcccccacccaagaatgagaggaagttttgttatgatgtttctagctgtcgttcatccttccctgagacaatgaacaagtggaacaccttttaccagtatttgcagtcaccttttagtaagtttgatgatctgttgaagtacttatgggctgcacacacttcaaccttggcagataatatcaaaagttttgaagacagatatgattattattctaaagcagaagcgcattttgagagaagttgggtactggctgtggatcatttagctgcagtcctctttcctacaaccttgattagatcatataagttccagaagggcatgccaccacgaattcttcttaatactgatgtagcccctttcatcagtgactttactgcttttcagaatgtagtcctggttcttctaaatatgcttgacaatgtggataaatctataggttatctttgtacagaaaaatctaatgtatatagagatcattcggaatctagctctagaagttatggaaataactcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 72
- chromosome 7 open reading frame 49
- vasodilator-stimulated phosphoprotein
- LIM and calponin homology domains 1

Buy C6orf58-chromosome 6 open reading frame 58 Gene now

Add to cart