PTXBC068200
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC068200 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LIMCH1 |
| Origin species: | Human |
| Product name: | LIMCH1-LIM and calponin homology domains 1 Gene |
| Size: | 2ug |
| Accessions: | BC068200 |
| Gene id: | 22998 |
| Gene description: | LIM and calponin homology domains 1 |
| Synonyms: | LIMCH1A; LMO7B; LIM and calponin homology domains-containing protein 1; LIM and calponin homology domains 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattccgaaagacaagtcaaggttaaggacactgatgacattgaaagtcctaaacgcagtatccgagacagtggctacatcgactgctgggattccgagcgcagcgactccctctctcctcctcgccacggcagagatgattccttcgacagcctggattcctttggctctcgctctcggcagacgccttcaccagatgtagtcctcaggggaagcagcgatgggagaggaagcgactctgaatccgacttgcctcatcggaagctgccagatgtgaagaaggatgacatgtctgcacggcggacttcccatggtgagccgaaatcagcagtgccttttaaccagtacctcccgaacaaaagcaatcagacggcctacgtccccgcgcctctgagaaagaagaaagcagagagagaggaataccgcaagagctggagtaccgccacctccccgctgggtggggagaggcccttcaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 2 open reading frame 79 - chromosome 8 open reading frame 45 - tubulointerstitial nephritis antigen - chromosome 9 open reading frame 82 |