No products
Prices are tax excluded
PTXBC068200
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC068200 |
Product type: | DNA & cDNA |
Ncbi symbol: | LIMCH1 |
Origin species: | Human |
Product name: | LIMCH1-LIM and calponin homology domains 1 Gene |
Size: | 2ug |
Accessions: | BC068200 |
Gene id: | 22998 |
Gene description: | LIM and calponin homology domains 1 |
Synonyms: | LIMCH1A; LMO7B; LIM and calponin homology domains-containing protein 1; LIM and calponin homology domains 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggattccgaaagacaagtcaaggttaaggacactgatgacattgaaagtcctaaacgcagtatccgagacagtggctacatcgactgctgggattccgagcgcagcgactccctctctcctcctcgccacggcagagatgattccttcgacagcctggattcctttggctctcgctctcggcagacgccttcaccagatgtagtcctcaggggaagcagcgatgggagaggaagcgactctgaatccgacttgcctcatcggaagctgccagatgtgaagaaggatgacatgtctgcacggcggacttcccatggtgagccgaaatcagcagtgccttttaaccagtacctcccgaacaaaagcaatcagacggcctacgtccccgcgcctctgagaaagaagaaagcagagagagaggaataccgcaagagctggagtaccgccacctccccgctgggtggggagaggcccttcaggtaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 2 open reading frame 79 - chromosome 8 open reading frame 45 - tubulointerstitial nephritis antigen - chromosome 9 open reading frame 82 |