Login to display prices
Login to display prices
NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene View larger

NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene

PTXBC041584

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene

Proteogenix catalog: PTXBC041584
Ncbi symbol: NUDT14
Product name: NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene
Size: 2ug
Accessions: BC041584
Gene id: 256281
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 14
Synonyms: UGPP; UGPPase; uridine diphosphate glucose pyrophosphatase; UDP-sugar diphosphatase; UDPG pyrophosphatase; nudix (nucleoside diphosphate linked moiety X)-type motif 14; nudix hydrolase 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgcatcgagggggcgtccgtgggccgctgcgccgcctcaccctacctgcggccgctcacgctgcattaccgccagaatggtgcccagaagtcctgggacttcatgaagacgcatgacagcgtgaccgttctcttattcaactcttctcggaggagcctggtgttggtgaagcagttccggccagctgtgtatgcgggtgaggtggagcgccgcttcccagggtccctagcagctgtagaccaggacgggcctcgggagctacagccagccctgcccggctcagcgggggtgacagttgagctgtgtgccggcctcgtggaccagcctgggctctcgctggaggaagtggcttgcaaggaggcttgggaggagtgtggctaccacttggccccctctgatctgcgccgggtcgccacatactggtctggagtgggactgactggctccagacagaccatgttctacacagaggtgacagatgcccagcgtagcggtccaggtgggggcctggtggaggagggtgagctcattgaggtggtgcacctgcccctggaaggcgcccaggcctttgcagacgacccggacatccccaagaccctcggcgtcatctttggtgtctcatggttcctcagccaggtggcccccaacctggatctccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: