Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene
PTXBC041584
New product
Data sheet of NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041584 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT14 |
| Origin species: | Human |
| Product name: | NUDT14-nudix (nucleoside diphosphate linked moiety X)-type motif 14 Gene |
| Size: | 2ug |
| Accessions: | BC041584 |
| Gene id: | 256281 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 14 |
| Synonyms: | UGPP; UGPPase; uridine diphosphate glucose pyrophosphatase; UDP-sugar diphosphatase; UDPG pyrophosphatase; nudix (nucleoside diphosphate linked moiety X)-type motif 14; nudix hydrolase 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcgcatcgagggggcgtccgtgggccgctgcgccgcctcaccctacctgcggccgctcacgctgcattaccgccagaatggtgcccagaagtcctgggacttcatgaagacgcatgacagcgtgaccgttctcttattcaactcttctcggaggagcctggtgttggtgaagcagttccggccagctgtgtatgcgggtgaggtggagcgccgcttcccagggtccctagcagctgtagaccaggacgggcctcgggagctacagccagccctgcccggctcagcgggggtgacagttgagctgtgtgccggcctcgtggaccagcctgggctctcgctggaggaagtggcttgcaaggaggcttgggaggagtgtggctaccacttggccccctctgatctgcgccgggtcgccacatactggtctggagtgggactgactggctccagacagaccatgttctacacagaggtgacagatgcccagcgtagcggtccaggtgggggcctggtggaggagggtgagctcattgaggtggtgcacctgcccctggaaggcgcccaggcctttgcagacgacccggacatccccaagaccctcggcgtcatctttggtgtctcatggttcctcagccaggtggcccccaacctggatctccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 - carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 - ubiquitin-conjugating enzyme E2D N-terminal like pseudogene - solute carrier family 27 (fatty acid transporter), member 4 |