Login to display prices
Login to display prices
GAS2-growth arrest-specific 2 Gene View larger

GAS2-growth arrest-specific 2 Gene

PTXBC013326

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAS2-growth arrest-specific 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GAS2-growth arrest-specific 2 Gene

Proteogenix catalog: PTXBC013326
Ncbi symbol: GAS2
Product name: GAS2-growth arrest-specific 2 Gene
Size: 2ug
Accessions: BC013326
Gene id: 2620
Gene description: growth arrest-specific 2
Synonyms: growth arrest-specific protein 2; GAS-2; growth arrest specific 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcactgctctgagcccaaaggtacgcagtgggcctggcctctctgatatgcatcagtatagccaatggctagccagcagacatgaagctaatttgctaccaatgaaagaagatctggccttgtggttaaccaatctattagggaaggagattacagcagaaacttttatggagaagttggacaatggtgccttgctctgtcaacttgcagaaactatgcaggagaaattcaaggagagcatggatgctaacaagcccacaaagaatctaccgttgaagaagatcccatgcaaaaccagtgcaccctcgggctccttttttgccagagacaatacagcaaatttcttatcctggtgccgagatttaggggtggatgaaacgtgtctatttgaatcggaaggtttgggatttggaggccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: