Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RPL13A-ribosomal protein L13a Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPL13A-ribosomal protein L13a Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC070223 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPL13A |
| Origin species: | Human |
| Product name: | RPL13A-ribosomal protein L13a Gene |
| Size: | 2ug |
| Accessions: | BC070223 |
| Gene id: | 23521 |
| Gene description: | ribosomal protein L13a |
| Synonyms: | L13A; TSTA1; 60S ribosomal protein L13a; 23 kDa highly basic protein; tissue specific transplantation antigen 1; ribosomal protein L13a |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaggtgcaggtcctggtgcttgatggtcgaggccatctcctgggccgcctggcggccatcgtggctaaacaggtactgctgggccggaaggtggtggtcgtacgctgtgaaggcatcaacatttctggcaatttctacagaaacaagttgaagtacctggctttcctccgcaagcggatgaacaccaacccttcccgaggcccctaccacttccgggcccccagccgcatcttctggcggaccgtgcgaggtatgctgccccacaaaaccaagcgaggccaggccgctctggaccgtctcaaggtgtttgacggcatcccaccgccctacgacaagaaaaagcggatggtggttcctgctgccctcaaggtcgtgcgtctgaagcctacaagaaagtttgcttatctggggcgcctggctcacgaggttggctggaagtaccaggcagtgacagccaccctggaggagaagaggaaagagaaagccaagatccactaccggaagaagaaacagctcatgaggctacggaaacaggccgagaagaacgtggagaagaaaattgacaaatacacagaggtcctcaagacccacggactcctggtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine aminopeptidase 3 - protein kinase C, delta - interleukin 23 receptor - neuromedin U receptor 2 |