RUVBL2-RuvB-like 2 (E. coli) Gene View larger

RUVBL2-RuvB-like 2 (E. coli) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RUVBL2-RuvB-like 2 (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RUVBL2-RuvB-like 2 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008355
Product type: DNA & cDNA
Ncbi symbol: RUVBL2
Origin species: Human
Product name: RUVBL2-RuvB-like 2 (E. coli) Gene
Size: 2ug
Accessions: BC008355
Gene id: 10856
Gene description: RuvB-like 2 (E. coli)
Synonyms: CGI-46; ECP-51; ECP51; INO80J; REPTIN; RVB2; TAP54-beta; TIH2; TIP48; TIP49B; ruvB-like 2; 48 kDa TATA box-binding protein-interacting protein; 48 kDa TBP-interacting protein; 51 kDa erythrocyte cytosolic protein; INO80 complex subunit J; RuvB (E coli homolog)-like 2; TIP60-associated protein 54-beta; erythrocyte cytosolic protein, 51-KD; repressing pontin 52; reptin52 protein; RuvB like AAA ATPase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaccgttacagccacaaccaaagtcccggagatccgtgatgtaacaaggattgagcgaatcggtgcccactcccacatccggggactggggctggacgatgccttggagcctcggcaggcttcgcaaggcatggtgggtcagctggcggcacggcgggcggctggcgtggtgctggagatgatccgggaagggaagattgccggtcgggcagtccttattgctggccagccgggcacggggaagacggccatcgccatgggcatggcgcaggccctgggccctgacacgccattcacagccatcgccggcagtgaaatcttctccctggagatgagcaagaccgaggcgctgacgcaggccttccggcggtccatcggcgttcgcatcaaggaggagacggagatcatcgaaggggaggtggtggagatccagattgatcgaccagcaacagggacgggctccaaggtgggcaaactgaccctcaagaccacagagatggagaccatctacgacctgggcaccaagatgattgagtccctgaccaaggacaagggacgtgatcaccatcgacaaggcgacgggcaagatctccaagttgggccgctccttcacacgcgcccgcgactacgacgctatgggctcccagaccaagttcgtgcagtgcccagatggggagctccagaaacgcaaggaggtggtgcacaccgtgtccctgcacgagatcgacgtcatcaactctcgcacccagggcttcctggcgctcttctcaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin 1, erythrocytic
- zinc finger protein 77
- LYR motif containing 5
- cardiolipin synthase 1

Buy RUVBL2-RuvB-like 2 (E. coli) Gene now

Add to cart