Login to display prices
Login to display prices
ANK1-ankyrin 1, erythrocytic Gene View larger

ANK1-ankyrin 1, erythrocytic Gene

PTXBC007930

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANK1-ankyrin 1, erythrocytic Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANK1-ankyrin 1, erythrocytic Gene

Proteogenix catalog: PTXBC007930
Ncbi symbol: ANK1
Product name: ANK1-ankyrin 1, erythrocytic Gene
Size: 2ug
Accessions: BC007930
Gene id: 286
Gene description: ankyrin 1, erythrocytic
Synonyms: ANK; SPH1; SPH2; ankyrin-1; ANK-1; ankyrin 1, erythrocytic; ankyrin-R; erythrocyte ankyrin; ankyrin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggactttcgtcacccagctgttggtcacgctggtgctgctgagcttcttcctggtcagctgtcagaacgtgatgcacattgtcagggggtccctgtgctttgtgctaaagcacatccaccaggagctggacaaggagctgggggagagcgagggcctcagtgacgacgaggagaccatctccaccagggtggtccggcggcgggtcttcctgaaggggaatgagtttcagaatattccaggggagcaggtgacagaggagcaattcacggatgagcagggcaacattgtcaccaagaagatcattcgcaaggtggttcgacagatagacttgtccagcgccgatgccgcccaggagcacgaggaggatcacacctcgacacccaacccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: