ANK1-ankyrin 1, erythrocytic Gene View larger

ANK1-ankyrin 1, erythrocytic Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANK1-ankyrin 1, erythrocytic Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ANK1-ankyrin 1, erythrocytic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007930
Product type: DNA & cDNA
Ncbi symbol: ANK1
Origin species: Human
Product name: ANK1-ankyrin 1, erythrocytic Gene
Size: 2ug
Accessions: BC007930
Gene id: 286
Gene description: ankyrin 1, erythrocytic
Synonyms: ANK; SPH1; SPH2; ankyrin-1; ANK-1; ankyrin 1, erythrocytic; ankyrin-R; erythrocyte ankyrin; ankyrin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggactttcgtcacccagctgttggtcacgctggtgctgctgagcttcttcctggtcagctgtcagaacgtgatgcacattgtcagggggtccctgtgctttgtgctaaagcacatccaccaggagctggacaaggagctgggggagagcgagggcctcagtgacgacgaggagaccatctccaccagggtggtccggcggcgggtcttcctgaaggggaatgagtttcagaatattccaggggagcaggtgacagaggagcaattcacggatgagcagggcaacattgtcaccaagaagatcattcgcaaggtggttcgacagatagacttgtccagcgccgatgccgcccaggagcacgaggaggatcacacctcgacacccaacccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 77
- LYR motif containing 5
- cardiolipin synthase 1
- homeobox containing 1

Buy ANK1-ankyrin 1, erythrocytic Gene now

Add to cart