TINAG-tubulointerstitial nephritis antigen Gene View larger

TINAG-tubulointerstitial nephritis antigen Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TINAG-tubulointerstitial nephritis antigen Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TINAG-tubulointerstitial nephritis antigen Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC056235
Product type: DNA & cDNA
Ncbi symbol: TINAG
Origin species: Human
Product name: TINAG-tubulointerstitial nephritis antigen Gene
Size: 2ug
Accessions: BC056235
Gene id: 27283
Gene description: tubulointerstitial nephritis antigen
Synonyms: TIN-AG; tubulointerstitial nephritis antigen
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaccggatataagatcttaatcttctcttatcttactacagaaatctggatggagaagcagtatttatctcaaagagaagtggacctagaggcttatttcactaggaatcacaccgttttgcaaggtactcgattcaaaagagccattttccaagggcaatactgtagaaattttggctgttgtgaagacagagatgatggctgtgtcactgagttctatgcggcgaatgcgttgtgctactgtgataaattctgtgacagagaaaattctgattgctgtcctgactacaagtccttttgccgtgaagagaaagaatggcctcctcacacacagccttggtatccagaaggttgcttcaaagatggtcaacattatgaagagggatcagtaattaaagaaaactgcaactcctggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 6 open reading frame 58
- chromosome 9 open reading frame 72
- chromosome 7 open reading frame 49
- vasodilator-stimulated phosphoprotein

Buy TINAG-tubulointerstitial nephritis antigen Gene now

Add to cart