AQP7-aquaporin 7 Gene View larger

AQP7-aquaporin 7 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AQP7-aquaporin 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AQP7-aquaporin 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC062701
Product type: DNA & cDNA
Ncbi symbol: AQP7
Origin species: Human
Product name: AQP7-aquaporin 7 Gene
Size: 2ug
Accessions: BC062701
Gene id: 364
Gene description: aquaporin 7
Synonyms: AQP7L; AQPap; GLYCQTL; aquaporin-7; aquaglyceroporin-7; aquaporin adipose; aquaporin 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttctaaataaaaaatatgggagctaccttggtgtcaacttgggttttggcttcggagtcaccatgggagtgcacgtggcaggccgcatctctggagcccacatgaacgcagctgtgacctttgctaactgtgcgctgggccgcgtgccctggaggaagtttccggtctatgtgctggggcagttcctgggctccttcctggcggctgccaccatctacagtctcttctacacggccattctccacttttcgggtggacagctgatggtgaccggtcccgtcgctacagctggcatttttgccacctaccttcctgatcacatgacattgtggcggggcttcctgaatgaggcgtggctgaccgggatgctccagctgtgtctcttcgccatcacggaccaggagaacaacccagcactgccaggaacagaggcgctggtgataggcatcctcgtggtcatcatcggggtgtcccttggcatgaacacaggatatgccatcaacccgtcccgggacctgcccccccgcatcttcaccttcattgctggttggggcaaacaggtcttcaggtggcatcatctacctggtcttcattggctccaccatcccacgggagcccctgaaattggaggattctgtggcgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tenomodulin
- cystatin SA
- keratin 17
- annexin A8

Buy AQP7-aquaporin 7 Gene now

Add to cart