TNMD-tenomodulin Gene View larger

TNMD-tenomodulin Gene

PTXBC034030

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNMD-tenomodulin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNMD-tenomodulin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034030
Product type: DNA & cDNA
Ncbi symbol: TNMD
Origin species: Human
Product name: TNMD-tenomodulin Gene
Size: 2ug
Accessions: BC034030
Gene id: 64102
Gene description: tenomodulin
Synonyms: BRICD4; CHM1L; TEM; tenomodulin; BRICHOS domain containing 4; chondromodulin-1-like protein; chondromodulin-I-like protein; chondromodulin-IB; hChM1L; hTeM; myodulin; tendin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaagaatcctccagagaattgtgaagactgtcacattctaaatgcagaagcttttaaatccaagaaaatatgtaaatcacttaagatttgtggactggtgtttggtatcctggccctaactctaattgtcctgttttgggggagcaagcacttctggccggaggtacccaaaaaagcctatgacatggagcacactttctacagcaatggagagaagaagaagatttacatggaaattgatcctgtgaccagaactgaaatattcagaagcggaaatggcactgatgaaacattggaagtgcacgactttaaaaacggatacactggcatctacttcgtgggtcttcaaaaatgttttatcaaaactcagattaaagtgattcctgaattttctgaaccagaagaggaaatagatgagaatgaagaaattaccacaactttctttgaacagtcagtgatttgggtcccagcagaaaagcctattgaaaaccgagattttcttaaaaattccaaaattctggagatttgtgataacgtgaccatgtattggatcaatcccactctaatatcaggtatgacattcttatcctcatcctcctcctattttctaagacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cystatin SA
- keratin 17
- annexin A8
- reticulon 4

Buy TNMD-tenomodulin Gene now

Add to cart