ZSCAN2-zinc finger and SCAN domain containing 2 Gene View larger

ZSCAN2-zinc finger and SCAN domain containing 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZSCAN2-zinc finger and SCAN domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZSCAN2-zinc finger and SCAN domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC041620
Product type: DNA & cDNA
Ncbi symbol: ZSCAN2
Origin species: Human
Product name: ZSCAN2-zinc finger and SCAN domain containing 2 Gene
Size: 2ug
Accessions: BC041620
Gene id: 54993
Gene description: zinc finger and SCAN domain containing 2
Synonyms: ZFP29; ZNF854; zinc finger and SCAN domain-containing protein 2; zfp-29; zinc finger protein 29 homolog; zinc finger protein 854; zinc finger and SCAN domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggctgcagacatcccgagagtgaccactccgctgagctccttggtccaggtgcctcaagaggaagatagacaggaggaggaggtcaccaccatgatcctggaggatgactcctgggtgcaagaagctgtgctgcaggaggatggccctgagtctgagccctttccccagagtgctggcaagggcggcccccaggaggaggtgaccaggggaccacagggtgcactcggccgcctccgagagctctgccggcgctggctgagaccagaggtacacaccaaggagcagatgttaaccatgctgccaaaggaaattcaggcttggctgcaagagcatcggcctgaaagcagtgaggaggcagcggccctggtggaagacttgacccagacccttcaggacagtgctgtagctgtctttgcttcccttccggtggaggtgaccagtttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
- DEAH (Asp-Glu-Ala-His) box polypeptide 32
- angiogenin, ribonuclease, RNase A family, 5
- Rab interacting lysosomal protein-like 1

Buy ZSCAN2-zinc finger and SCAN domain containing 2 Gene now

Add to cart