Login to display prices
Login to display prices
ZSCAN2-zinc finger and SCAN domain containing 2 Gene View larger

ZSCAN2-zinc finger and SCAN domain containing 2 Gene

PTXBC041620

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZSCAN2-zinc finger and SCAN domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZSCAN2-zinc finger and SCAN domain containing 2 Gene

Proteogenix catalog: PTXBC041620
Ncbi symbol: ZSCAN2
Product name: ZSCAN2-zinc finger and SCAN domain containing 2 Gene
Size: 2ug
Accessions: BC041620
Gene id: 54993
Gene description: zinc finger and SCAN domain containing 2
Synonyms: ZFP29; ZNF854; zinc finger and SCAN domain-containing protein 2; zfp-29; zinc finger protein 29 homolog; zinc finger protein 854; zinc finger and SCAN domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggctgcagacatcccgagagtgaccactccgctgagctccttggtccaggtgcctcaagaggaagatagacaggaggaggaggtcaccaccatgatcctggaggatgactcctgggtgcaagaagctgtgctgcaggaggatggccctgagtctgagccctttccccagagtgctggcaagggcggcccccaggaggaggtgaccaggggaccacagggtgcactcggccgcctccgagagctctgccggcgctggctgagaccagaggtacacaccaaggagcagatgttaaccatgctgccaaaggaaattcaggcttggctgcaagagcatcggcctgaaagcagtgaggaggcagcggccctggtggaagacttgacccagacccttcaggacagtgctgtagctgtctttgcttcccttccggtggaggtgaccagtttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: