DDX53-DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 Gene View larger

DDX53-DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 Gene


New product

Data sheet of DDX53-DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDX53-DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC067878
Product type: DNA & cDNA
Ncbi symbol: DDX53
Origin species: Human
Product name: DDX53-DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 Gene
Size: 2ug
Accessions: BC067878
Gene id: 168400
Gene description: DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
Synonyms: CT26; DEAD box protein 53; DEAD (Asp-Glu-Ala-Asp) box polypeptide 53; DEAD-box protein CAGE; cancer-associated gene protein; cancer/testis antigen 26; DEAD-box helicase 53
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccactgggccccagagtggaagagggcggaggctaatccaagagaccttggggccagctgggatgtcaggggcagcagaggcagtggctggagtggccccttcggccatcagggaccgagagcagcaggctcccgtgaaccaccactctgctttaaaataaagaacaatatggttggtgtggtcattggttacagtggatcaaaaataaaagatctacaacattcgacaaacactaaaatacagatcataaacggggaatctgaagcaaaagtcagaatttttggcaatagggaaatgaaagcaaaggccaaagcggctatagaaacacttattagaaaacaagaaagctacaactcagaatccagtgtggataatgctgcatcccaaacccctattggaagaaatctaggcagaaatgacattgttggagaagctgagccattgtcaaattgggatcgcattagggcagcagtcgtggagtgcgaaaagagaaaatgggcagatctaccaccagttaagaaaaacttttacatagaatccaaagcaacaagctgcatgtctgaaatgcaggtgattaactggagaaaggaaaatttcaacataacgtgtgatgacttgaaaagtggtgaaaagcgtctcattccaaaaccaacttgcaggtttaaagacgcttttcagcaataccctgatcttctgaaaagcataataagggtagggattttaaagccaacgccaattcagtcacaggcatggccaattattctacaaggaatagatcttatagtagttgcacaaaccggaacagggaaaacattgtcctatctaatgcctgggtttattcatcttgattctcaaccaatatctagagagcaaaggaatgggcctgggatgctagtccttacacccactagagagttggctcttcacgtggaagctgaatgttcaaagtattcatataaaggtctcaaaagcatttgcatatatggtggtagaaacagaaatggacaaatagaagacattagcaaaggtgtagatatcattattgcaactcctgggaggctgaatgacctacaaatgaataactctgtcaacctaagaagcataacctacttggttatagatgaggcagataaaatgctggatatggaatttgaaccccagataaggaagattttattagatgtgcgcccagaccgacagactgttatgacaagtgcaacttggccagatactgtacgtcaactagcactttcttatttgaaagatcctatgattgtttatgttggtaatctgaatctagtggctgtaaatacagtgaagcaaaatataattgttaccacagaaaaagaaaaacgagctctcacccaagaattcgtagagaacatgtcacccaacgacaaagtcatcatgtttgtcagccaaaaacatattgctgatgacttgtcaagcgacttcaatatccaaggcatatctgcagaatcattacatggcaacagtgaacagagtgatcaagagcgagcagtagaggactttaaaagcggaaacataaagatactgattacaactgatatagtatcccgaggtcttgatcttaatgatgtcacacatgtatataattatgatttcccaaggaatattgacgtatatgtacacagagtagggtacattggacggacaggaaagactggcacatcagttaccctcatcactcagagagattcgaaaatggccggtgaattgattaaaattctggacagagcaaatcagagtgttccggaagatcttgtagtaatggctgagcaatacaagttaaatcaacaaaagaggcacagagaaacacgatcaagagaacctggacaaagacgcaaggagttttattttttaagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DEAH (Asp-Glu-Ala-His) box polypeptide 32
- angiogenin, ribonuclease, RNase A family, 5
- Rab interacting lysosomal protein-like 1
- splicing factor, arginine/serine-rich 16

Buy DDX53-DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 Gene now

Add to cart