Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MMD2-monocyte to macrophage differentiation-associated 2 Gene
PTXBC067905
New product
Data sheet of MMD2-monocyte to macrophage differentiation-associated 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MMD2-monocyte to macrophage differentiation-associated 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067905 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MMD2 |
| Origin species: | Human |
| Product name: | MMD2-monocyte to macrophage differentiation-associated 2 Gene |
| Size: | 2ug |
| Accessions: | BC067905 |
| Gene id: | 221938 |
| Gene description: | monocyte to macrophage differentiation-associated 2 |
| Synonyms: | PAQR10; monocyte to macrophage differentiation factor 2; monocyte-to-macrophage differentiation-associated protein 2; progestin and adipoQ receptor family member 10; progestin and adipoQ receptor family member X; monocyte to macrophage differentiation associated 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcgccccccggctgctggatttccagaagacgaaatacgcgaggttcatgaaccaccgagtccctgcccacaagaggtaccagcccacagagtatgaacatgcggccaactgtgccacccatgctttctggatcatccccagcatcctgggcagctccaacctctacttcctgtcggacgatgactgggagaccatctctgcctggatctacggcctcggcctctgcggcctcttcgtggtgtccactgtgtttcacaccatctcctggaagaagagccacctaaggatggtggaacactgtatacacatgttcgaccggatggtcatctatttcttcatagcggcttcctacgcaccctggctgaaccttcgggagctgggcccctgggcctcccacatgcgctggctggtctggattatggcttccgtgggcaccatctatgtcttcttcttccatgagcggtacaagcttgtggagcttctctgctacgtcgtaatgggcttcttccccgccctggtcatcctctccatgcccaacaccgagggcatctgggagctggtgaccggaggggtcttctactgcctgggcatggtcttcttcaagagtgacgggaggatcccctttgcccacgcaatctggcatctctttgtagcatttggtgctggtacccactactatgccatctggaggtacctctatctgcccagcaccctgcagaccaaggtgtccaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Rho guanine nucleotide exchange factor (GEF) 10 - host cell factor C1 regulator 1 (XPO1 dependent) - ATG4 autophagy related 4 homolog D (S. cerevisiae) - leucine rich repeat containing 8 family, member A |