ARHGEF10-Rho guanine nucleotide exchange factor (GEF) 10 Gene View larger

ARHGEF10-Rho guanine nucleotide exchange factor (GEF) 10 Gene

PTXBC040474

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARHGEF10-Rho guanine nucleotide exchange factor (GEF) 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGEF10-Rho guanine nucleotide exchange factor (GEF) 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040474
Product type: DNA & cDNA
Ncbi symbol: ARHGEF10
Origin species: Human
Product name: ARHGEF10-Rho guanine nucleotide exchange factor (GEF) 10 Gene
Size: 2ug
Accessions: BC040474
Gene id: 9639
Gene description: Rho guanine nucleotide exchange factor (GEF) 10
Synonyms: GEF10; SNCV; rho guanine nucleotide exchange factor 10; Rho guanine nucleotide exchange factor (GEF) 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaatccagaagaagcaatttacgatgacgttccaagggaaaactcagactctgaaccagatgaaatgatttatgatgatgttgagaatggggatgaaggtggaaacagctccttggaatacggatggagttcgagtgaatttgaaagttacgaagagcagagtgactcggagtgcaagaatgggattcccaggtccttcctgcgcagcaaccacaaaaagcaaatgcagaagctcgtgaaggccgcgaaggacggcaccaaggacgggctggagaggaccagggcagccgtgaagaggggccgctccttcatcaggaccaagtctctcatcgcacaggatcacagatcttctcttgaggaagaacagaatttgttcattgatgttgactgcaagcacccggaagccatcttgaccccgatgcccgagggtttatctcagcagcaggttgtaagaagatatatactgggttcagttgtcgacagtgaaaagaactacgtagatgctcttaagaggattttggagcaatatgagaagccgctgtctgagatggagccaaaggttctgagtgagaggaagctgaagacggtgttctaccgagtcaaagagatcctgcagtgccactcgctatttcagatcgcgctggccagccgcgtttccgagtgggactccgtggaaatgataggcgttgtcttcgtggcttcgttttctaagtccatggtgctggatgcatacagtgaatatgtgaacaatttcagcacagccgtggcagtcctcaagaaaacatgtgccacaaagcccgcttttcttgaatttttaaagcaggaacaggaggccagccccgatcgaaccacgctctacagcctgatgatgaagcccatccagaggttcccacagttcatcctcctgctccaggacatgctgaagaacacctccaaaggccaccccgacaggctgcctcttcagatggccctgacagagctcgaaacactagcagagaagttaaatgaaagaaagagagatgctgatcaacgctgtgaagtgaagcaaatagccaaagccataaacgaaagatacctgaacaaggttgagagaggttttcttcaactctattccaaaattatttttgctttgtgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - host cell factor C1 regulator 1 (XPO1 dependent)
- ATG4 autophagy related 4 homolog D (S. cerevisiae)
- leucine rich repeat containing 8 family, member A
- leucine rich repeat containing 8 family, member D

Buy ARHGEF10-Rho guanine nucleotide exchange factor (GEF) 10 Gene now

Add to cart