Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ARHGAP24-Rho GTPase activating protein 24 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARHGAP24-Rho GTPase activating protein 24 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047918 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARHGAP24 |
| Origin species: | Human |
| Product name: | ARHGAP24-Rho GTPase activating protein 24 Gene |
| Size: | 2ug |
| Accessions: | BC047918 |
| Gene id: | 83478 |
| Gene description: | Rho GTPase activating protein 24 |
| Synonyms: | FILGAP; RC-GAP72; RCGAP72; p73; p73RhoGAP; rho GTPase-activating protein 24; RAC1- and CDC42-specific GTPase-activating protein of 72 kDa; filamin-A-associated RhoGAP; rhoGAP of 73 kDa; sarcoma antigen NY-SAR-88; Rho GTPase activating protein 24 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagaacaatgactccacggagaacccccaacaaggccaagggcggcagaatgccatcaagtgtgggtggctgaggaagcaaggaggctttgtcaagacttggcatactcgctggtttgtgctcaagggggatcagctctattatttcaaagatgaagatgaaaccaagcccttgggtactatttttctgcctggaaataaagtttctgagcatccctgcaatgaagagaacccagggaagttcctttttgaagtagttccaggaggcgatcgagatcggatgacagcaaatcatgagagctacctcctcatggcaagcacccagaatgatatggaagactgggtgaagtcaatccgccgagtcatatggggacctttcggaggaggcatttttggacagaaactggaggatactgttcgttatgagaagagatatgggaaccgtctggctccgatgttggtggagcagtgcgtggactttatccgacaaagggggctgaaagaagagggtctctttcgactgccaggccaggctaatcttgttaaggagctccaagatgcctttgactgtggggagaagccatcatttgacagcaacacagatgtacacacggtggcatcacttcttaagctgtacctccgagaacttccagaaccagttattccttatgcgaagtatgaagattttttgtcatgtgccaaactgctcagcaaggaagaggaagcagtaagttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - baculoviral IAP repeat-containing 8 - coiled-coil domain containing 74B - microfibrillar-associated protein 4 - trinucleotide repeat containing 6A |