> >>TNRC6A-trinucleotide repeat containing 6A Gene
TNRC6A-trinucleotide repeat containing 6A Gene View larger

TNRC6A-trinucleotide repeat containing 6A Gene

PTXBC068209

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of TNRC6A-trinucleotide repeat containing 6A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNRC6A-trinucleotide repeat containing 6A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC068209
Product type: DNA & cDNA
Ncbi symbol: TNRC6A
Origin species: Human
Product name: TNRC6A-trinucleotide repeat containing 6A Gene
Size: 2ug
Accessions: BC068209
Gene id: 27327
Gene description: trinucleotide repeat containing 6A
Synonyms: CAGH26; GW1; TNRC6; trinucleotide repeat-containing gene 6A protein; CAG repeat protein 26; CTD-2540M10.1; EDIE; EMSY interactor protein; GW182 autoantigen; glycine-tryptophan protein of 182 kDa; trinucleotide repeat containing 6A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcacggcccgctgatcacattccacctgaacctccctcacggaaatgctctggtccgctacagttcaaaagaagaggtagtgaaggcacaaaagtctctgcacatgtgtgtactggggaacactactattcttgctgagtttgccagtgaagaggagatcagtcgtttctttgcacaaagccagtctctgaccccttctcccggctggcagtctctcgggtccagccagagccggctgggctccctcgactgttcccactcattctccagccggaccgatctcaatcactggaatggtgctgggctgtcgggaactaactgtggagaccttcacggcacttcactctgggggaccccgcattattccacaagcctgtggggtcccccaagcagcagcgacccccgaggaattagcagcccatctcccattaacgcttttctttctgttgaccacctgggtgggggtggagagtccatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - oxysterol binding protein-like 1A
- gap junction protein, alpha 4, 37kDa
- LIM domain only 2 (rhombotin-like 1)
- similar to ribosomal protein S14

Reviews

Buy TNRC6A-trinucleotide repeat containing 6A Gene now

Add to cart