Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LOC645683-ribosomal protein L13a pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC645683-ribosomal protein L13a pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067891 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC645683 |
| Origin species: | Human |
| Product name: | LOC645683-ribosomal protein L13a pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC067891 |
| Gene id: | 645683 |
| Gene description: | ribosomal protein L13a pseudogene |
| Synonyms: | ADMIO; ADMIO1; APRF; HIES; signal transducer and activator of transcription 3; DNA-binding protein APRF; acute-phase response factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcgccacaagaccaagcgaggccatgcctccctggactgcctcaaggtgtttgacggcatcccaccgccctacgataagaaaaagcggatggtggttcctgctgccctcaaggtcgtgcgtctgaagcctacaagaaagtttgcccttctggggcgacaggctcaagaggttaggtggaagtaccaggcagtgacagccaccctggaggagaagaggaaggagaaagccaagatccactactggaagaagaaacagctcatgaggctacggaaacaggccgagaagaacgtgaagaaaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-C motif) receptor-like 2 - Rho GTPase activating protein 11A - receptor interacting protein kinase 5 - GrpE-like 2, mitochondrial (E. coli) |