Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCDC80-coiled-coil domain containing 80 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCDC80-coiled-coil domain containing 80 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042105 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCDC80 |
| Origin species: | Human |
| Product name: | CCDC80-coiled-coil domain containing 80 Gene |
| Size: | 2ug |
| Accessions: | BC042105 |
| Gene id: | 151887 |
| Gene description: | coiled-coil domain containing 80 |
| Synonyms: | DRO1; SSG1; URB; okuribin; coiled-coil domain-containing protein 80; down-regulated by oncogenes protein 1; nuclear envelope protein okuribin; steroid sensitive gene 1; up-regulated in BRS-3 deficient mouse homolog; coiled-coil domain containing 80 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttctagtcggaaaagacggaaatgtcaaatcctggtatccttccccaatgtggtccatggtgattgtgtacgatttaattgattcgatgcaacttcggagacaggaaatggcgattcagcagtcactggggatgcgctgcccagaagatgagtatgcaggctatggttaccatagttaccaccaaggataccaggatggttaccaggatgactaccgtcatcatgagagttatcaccatggatacccttactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ornithine decarboxylase antizyme 3 - voltage-dependent anion channel 2 - interleukin 23, alpha subunit p19 - Rho GTPase activating protein 5 |