Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL23A-interleukin 23, alpha subunit p19 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL23A-interleukin 23, alpha subunit p19 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067511 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL23A |
| Origin species: | Human |
| Product name: | IL23A-interleukin 23, alpha subunit p19 Gene |
| Size: | 2ug |
| Accessions: | BC067511 |
| Gene id: | 51561 |
| Gene description: | interleukin 23, alpha subunit p19 |
| Synonyms: | IL-23; IL-23A; IL23P19; P19; SGRF; interleukin-23 subunit alpha; IL-23 subunit alpha; IL-23-A; IL-23p19; JKA3 induced upon T-cell activation; interleukin 23 p19 subunit; interleukin 23, alpha subunit p19; interleukin-23 subunit p19; interleukin-six, G-CSF related factor; interleukin 23 subunit alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggggagcagagctgtaatgctgctgttgctgctgccctggacagctcagggcagagctgtgcctgggggcagcagccctgcctggactcagtgccagcagctttcacagaagctctgcacactggcctggagtgcacatccactagtgggacacatggatctaagagaagagggagatgaagagactacaaatgatgttccccatatccagtgtggagatggctgtgacccccaaggactcagggacaacagtcagttctgcttgcaaaggatccaccagggtctgattttttatgagaagctgctaggatcggatattttcacaggggagccttctctgctccctgatagccctgtgggccagcttcatgcctccctactgggcctcagccaactcctgcagcctgagggtcaccactgggagactcagcagattccaagcctcagtcccagccagccatggcagcgtctccttctccgcttcaaaatccttcgcagcctccaggcctttgtggctgtagccgcccgggtctttgcccatggagcagcaaccctgagtccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Rho GTPase activating protein 5 - interleukin 23, alpha subunit p19 - FERM and PDZ domain containing 2 - RAB1B, member RAS oncogene family |