Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GTF2IRD2-GTF2I repeat domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GTF2IRD2-GTF2I repeat domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047706 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GTF2IRD2 |
| Origin species: | Human |
| Product name: | GTF2IRD2-GTF2I repeat domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC047706 |
| Gene id: | 84163 |
| Gene description: | GTF2I repeat domain containing 2 |
| Synonyms: | transcription factor GTF2IRD2-alpha; GTF2IRD2 alpha; FP630; GTF2IRD2A; general transcription factor II-I repeat domain-containing protein 2A; GTF2I repeat domain-containing protein 2, alpha; GTF2I repeat domain-containing protein 2A; general transcription factor II i repeat domain 2 alpha; GTF2I repeat domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccaggtagcagtgtccaccctgcctgttgaagaagagtcctcctcagagaccaggatggtggtgacattcctcgtgtctgccctcgaatccatgtgtaaagaactggccgagtccaaggcagaagtggcctgcatcgcagtgtacgaaacagacgtgtttgtcgtcggaaccgagagaggatgcgcttttgttaatgccaggacggattttcagaaagattttgcaaaatactgcgttgcagagggactgtgtgaggtgaaacctccctgccctgtgaacgggatgcaggtccactcgggcgaaacggaaatactcaggaaggcagtggaggactatttctgcttttgttatggtaaagccttagggacaacagtgatggtgcctgttccctatgagaagatgctgcgagaccagtcggctgtggtagtgcaggggcttccggaaggcgttgcctttcaacaccctgagaattacgaccttgcaaccctgaaatggattttggagaacaaagcagggatttcattcatcataaatagacccttcctaggaccagagagtcagctgggtggccctgggatggtaacagatgcggagagatccatagtatcaccaagtgaaagctgcggccccatcaatgtgaaaactgaacccatggaagattctggtgggtaccaagatgcttttagaatcaagtatcggccaagcgtggtagctcacgcctgtaatcccagcaatttgggaggccgaggcaggcggatcacttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin and Sec7 domain containing - inhibitor of growth family, member 3 - baculoviral IAP repeat-containing 8 - Rho GTPase activating protein 24 |