PTXBC031830
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031830 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLHL32 |
| Origin species: | Human |
| Product name: | KLHL32-kelch-like 32 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC031830 |
| Gene id: | 114792 |
| Gene description: | kelch-like 32 (Drosophila) |
| Synonyms: | BKLHD5; KIAA1900; UG0030H05; dJ21F7.1; kelch-like protein 32; BTB and kelch domain containing 5; kelch like family member 32 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgtctgaacgctgcctcagtattcaagaaatgctgacaggccagaggctctgccactccgaatctcacaatgacagtgtcctggcagcgctgaatcagcagaggagtgatggcatcctctgcgacatcaccctgattgctgaggaacagaaattccatgctcacaaggcagtcctagcagcatgcagtgactatttccgggcaatgttcagtctttgtatggtggaaagtggagctgatgaggttaatttgcacggtgtgaccagccttggcttaaagcaggctctggagtttgcatacacaggacagattttgctggagccaggtgtgatccaggatgtgctagcagcgggcagtcacctacagctgttggagcttctcaatttatgctcccactatctcatccaggtggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ER lipid raft associated 2 - kelch-like 17 (Drosophila) - ataxia telangiectasia mutated - transmembrane protein 14B |