Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ERLIN2-ER lipid raft associated 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ERLIN2-ER lipid raft associated 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC048308 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ERLIN2 |
| Origin species: | Human |
| Product name: | ERLIN2-ER lipid raft associated 2 Gene |
| Size: | 2ug |
| Accessions: | BC048308 |
| Gene id: | 11160 |
| Gene description: | ER lipid raft associated 2 |
| Synonyms: | C8orf2; Erlin-2; NET32; SPFH2; SPG18; SPFH domain family, member 2; endoplasmic reticulum lipid raft-associated protein 2; spastic paraplegia 18 (autosomal dominant); stomatin-prohibitin-flotillin-HflC/K domain-containing protein 2; ER lipid raft associated 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcagttgggagcagttgtggctgtggcttccagtttcttttgtgcatctctcttctcagctgtgcacaagatagaagagggacatattggggtatattacagaggcggtgccctgctgacttcgaccagcggccctggtttccatctcatgctccctttcatcacatcatataagtctgtgcagaccacactccagacagatgaggtgaagaatgtaccttgtgggactagtggtggtgtgatgatctactttgacagaattgaagtggtgaacttcctggtcccgaacgcagtgtatgatatagtgaagaactatactgctgactatgacaaggccctcatcttcaacaagatccaccacgaactgaaccagttctgcagtgtgcacacgcttcaagaggtctacattgagctgtttggactggaaaatgatttttcccaggaatcttcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - kelch-like 17 (Drosophila) - ataxia telangiectasia mutated - transmembrane protein 14B - shugoshin-like 2 (S. pombe) |