PTXBC069718
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix | 
| Product type | DNA & cDNA | 
| Origin species | Human | 
| Brand: | ProteoGenix | 
| Proteogenix catalog: | PTXBC069718 | 
| Product type: | DNA & cDNA | 
| Ncbi symbol: | RGS8 | 
| Origin species: | Human | 
| Product name: | RGS8-regulator of G-protein signaling 8 Gene | 
| Size: | 2ug | 
| Accessions: | BC069718 | 
| Gene id: | 85397 | 
| Gene description: | regulator of G-protein signaling 8 | 
| Synonyms: | regulator of G-protein signaling 8; regulator of G-protein signalling 8 | 
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG | 
| Orf sequence: | atgtggaacaccttaacccgaagcctctctgaccatccagttggcaaagaccctcaggccatgaggactggccaaagacagaacaaagggatgaggactcgactgggatgcctgtctcacaagtcagactcgtgtagtgatttcacagctattcttccagacaaacccaaccgcgctctcaagagattatcgacagaagaagctacgaggtgggcagattcctttgatgtgcttctctctcataagtatggggtggctgcattccgtgccttcttgaagacggagttcagtgaggagaacctggaattctggttggcctgtgaggagttcaagaagaccaggtccactgcaaaactggtctctaaggcccataggatctttgaggagtttgtggatgtgcaggctccacgggaggtaaacattgacttccagacccgagaagccacgaggaagaacctgcaggagccatccctgacttgctttgaccaagcccaaggaaaagtacacagcctcatggagaaagactcttaccccaggttcctgaggtccaaaatgtacttagatctgctgtcccaaagccagaggaggctcagttag | 
| Vector: | pDONR223 | 
| Delivery lead time in business days in europe: | 10-12 days | 
| Storage: | -20â | 
| Delivery condition: | Blue Ice | 
| Related products: | - taste receptor, type 2, member 8 - coiled-coil domain containing 80 - ornithine decarboxylase antizyme 3 - voltage-dependent anion channel 2  |