> >>HIST1H1A-histone cluster 1, H1a Gene
HIST1H1A-histone cluster 1, H1a Gene View larger

HIST1H1A-histone cluster 1, H1a Gene

PTXBC069492

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of HIST1H1A-histone cluster 1, H1a Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H1A-histone cluster 1, H1a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC069492
Product type: DNA & cDNA
Ncbi symbol: HIST1H1A
Origin species: Human
Product name: HIST1H1A-histone cluster 1, H1a Gene
Size: 2ug
Accessions: BC069492
Gene id: 3024
Gene description: histone cluster 1, H1a
Synonyms: H1.1; H1A; H1F1; HIST1; histone H1.1; H1 histone family, member 1; histone 1, H1a; histone H1a; histone cluster 1, H1a; histone cluster 1 H1 family member a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgaaacagtgcctcccgcccccgccgcttctgctgctcctgagaaacctttagctggcaagaaggcaaagaaacctgctaaggctgcagcagcctccaagaaaaaacccgctggcccttccgtgtcagagctgatcgtgcaggctgcttcctcctctaaggagcgtggtggtgtgtcgttggcagctcttaaaaaggcgctggcggccgcaggctacgacgtggagaagaacaacagccgcattaagctgggcattaagagcctggtaagcaagggaacgttggtgcagacaaagggtaccggagcctcgggttccttcaagctcaacaagaaggcgtcctccgtggaaaccaagcccggcgcctcaaaggtggctacaaaaactaaggcaacgggtgcatctaaaaagctcaaaaaggccacgggggctagcaaaaagagcgtcaagactccgaaaaaggctaaaaagcctgcggcaacaaggaaatcctccaagaatccaaaaaaacccaaaactgtaaagcccaagaaagtagctaaaagccctgctaaagctaaggctgtaaaacccaaggcggccaaggctagggtgacgaagccaaagactgccaaacccaagaaagcggcacccaagaaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone cluster 1, H1t
- MAX dimerization protein 1
- kelch-like 7 (Drosophila)
- sialic acid acetylesterase

Reviews

Buy HIST1H1A-histone cluster 1, H1a Gene now

Add to cart