Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H1T-histone cluster 1, H1t Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H1T-histone cluster 1, H1t Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069517 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H1T |
| Origin species: | Human |
| Product name: | HIST1H1T-histone cluster 1, H1t Gene |
| Size: | 2ug |
| Accessions: | BC069517 |
| Gene id: | 3010 |
| Gene description: | histone cluster 1, H1t |
| Synonyms: | H1.6; H1FT; dJ221C16.2; histone H1t; H1 histone family, member T (testis-specific); histone 1, H1t; histone cluster 1, H1t; testicular H1 histone; histone cluster 1 H1 family member t |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttttcgctggttattacatcttgcgtttctctgttgttatgtctgaaaccgtgcctgcagcttctgccagtgctggtgtagccgctatggagaaacttccaaccaagaagcgagggaggaagccggctggcttgataagtgcaagtcgcaaagtgccgaacctctctgtgtccaagttgatcaccgaggccctttcagtgtcacaggaacgagtaggtatgtctttggttgcgctcaagaaggcattggccgctgctggctacgacgtagagaagaataacagccgcatcaaactgtccctcaagagcttagtgaacaagggaatcctggtgcaaaccaggggtactggtgcttccggttcctttaagcttagtaagaaggtgattcctaaatctaccagaagcaaggctaaaaagtcagtttctgccaagaccaagaagctggttttatccagggactccaagtcaccaaagactgctaaaaccaataagagagccaagaagccgagagcgacaactcctaaaactgttaggagcgggagaaaggctaaaggagccaagggtaagcaacagcagaagagcccagtgaaggcaagggcttcgaagtcaaaattgacccaacatcatgaagttaatgttagaaaggccacatctaagaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MAX dimerization protein 1 - kelch-like 7 (Drosophila) - sialic acid acetylesterase - RWD domain containing 4A |