HIST1H4L-histone cluster 1, H4l Gene View larger

HIST1H4L-histone cluster 1, H4l Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H4L-histone cluster 1, H4l Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H4L-histone cluster 1, H4l Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC069392
Product type: DNA & cDNA
Ncbi symbol: HIST1H4L
Origin species: Human
Product name: HIST1H4L-histone cluster 1, H4l Gene
Size: 2ug
Accessions: BC069392
Gene id: 8368
Gene description: histone cluster 1, H4l
Synonyms: H4/m; H4FM; H4M; histone H4; H4 histone family, member M; Histone 4 family, member M; histone 1, H4i; histone cluster 1, H4i; histone family member; histone cluster 1 H4 family member i
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgggcgcggcaaaggcgggaagggtctgggcaaaggaggcgctaagcgccaccgcaaagttctgcgcgacaacattcagggcatcaccaagcccgccatccgacgcctggcacggcgtggaggcgttaagcgcatctcaggccttatatacgaggagacacgcggagttcttaaagtgtttttggagaatgtaatccgcgatgcagttacctacacggagcacgccaaacgcaagacagtcacagccatggacgtggtttacgcgctcaagcgccagggccgcaccctgtatggctttggcggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone cluster 1, H3a
- tubulin folding cofactor D
- zer-1 homolog (C. elegans)
- histone cluster 1, H4a

Buy HIST1H4L-histone cluster 1, H4l Gene now

Add to cart