HIST1H3A-histone cluster 1, H3a Gene View larger

HIST1H3A-histone cluster 1, H3a Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H3A-histone cluster 1, H3a Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H3A-histone cluster 1, H3a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC069303
Product type: DNA & cDNA
Ncbi symbol: HIST1H3A
Origin species: Human
Product name: HIST1H3A-histone cluster 1, H3a Gene
Size: 2ug
Accessions: BC069303
Gene id: 8350
Gene description: histone cluster 1, H3a
Synonyms: H3/A; H3FA; histone H3.1; H3 histone family, member A; histone 1, H3a; histone H3/a; histone cluster 1, H3a; histone cluster 1 H3 family member a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcgcactaagcaaactgctcggaagtctactggtggcaaggcgccacgcaaacagttggccactaaggcagcccgcaaaagcgctccggccaccggcggcgtgaaaaagccccaccgctaccggccgggcaccgtggctctgcgcgagatccgccgttatcagaagtccactgaactgcttattcgtaaactacctttccagcgcctggtgcgcgagattgcgcaggactttaaaacagacctgcgtttccagagctccgctgtgatggctctgcaggaggcgtgcgaggcctacttggtagggctatttgaggacactaacctgtgcgccatccacgccaagcgcgtcactatcatgcccaaggacatccagctcgcccgccgcatccgcggagagagggcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulin folding cofactor D
- zer-1 homolog (C. elegans)
- histone cluster 1, H4a
- histone cluster 1, H4b

Buy HIST1H3A-histone cluster 1, H3a Gene now

Add to cart