SARS2-seryl-tRNA synthetase 2, mitochondrial Gene View larger

SARS2-seryl-tRNA synthetase 2, mitochondrial Gene


New product

Data sheet of SARS2-seryl-tRNA synthetase 2, mitochondrial Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SARS2-seryl-tRNA synthetase 2, mitochondrial Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC042912
Product type: DNA & cDNA
Ncbi symbol: SARS2
Origin species: Human
Product name: SARS2-seryl-tRNA synthetase 2, mitochondrial Gene
Size: 2ug
Accessions: BC042912
Gene id: 54938
Gene description: seryl-tRNA synthetase 2, mitochondrial
Synonyms: SARS; SARSM; SERS; SYS; SerRS; SerRSmt; mtSerRS; serine--tRNA ligase, mitochondrial; mitochondrial seryl-tRNA synthetase; serine tRNA ligase 2, mitochondrial; seryl-tRNA synthetase, mitochondrial; seryl-tRNA(Ser/Sec) synthetase; seryl-tRNA synthetase 2, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcgtccatggcgcggcgcttgtggcctttgctgactcgtcgggggttccggccccggggaggctgcatctccaacgatagtccaaggagaagtttcactacagagaaacgaaaccggaacctcctgtacgagtatgcgcgcgagggctacagcgcactccctcagctggacatagagcggttctgcgcatgcccagaagaggccgcacacgccctggagctccgcaagggggagctgcgctcggcggacctgcccgcgatcatctcgacatggcaggagctgaggcagctgcaggagcagatccggagcctggaggaagagaaggcagctgtgactgaggcagtgcgggccctgctggcaaaccaggacagtggtgaagtgcagcaggaccccaagtaccagggtctgcgggcacgtggccgggagatccggaaggagcttgttcacctgtaccccagggaggcccagcttgaggagcagttctacctgcaggcgctgaagctgcccaaccagacccacccagacgtgcccgtcggggatgagagccaggctcgagtgctccacatggtcggagacaagccagttttctccttccaacctcggggccacctggaaattggcgagaaactcgacatcatccgtcagaagcgcctgtcccacgtgtctggccaccggtcctattacctgcgcggggctggagccctcctgcagcacggcctggtcaacttcacattcaacaagcttctccgccggggcttcacccccatgacggtgccagaccttctccgcggagcagtgtttgaaggctgtgggatgacaccaaatgccaacccatcccaaatttacaacatcgaccctgcccgcttcaaagatctcaacctggctggaacagcggaggtggggcttgcaggctacttcatggaccacaccgtggccttcagggacctgccagtcaggatggtttgctccagcacctgctaccgggcagagacaaacacgggacaggaaccccgggggctgtatcgagtacaccacttcaccaaggtggagatgtttggggtgacaggccctgggctggagcagagctcacagctgctggaggagttcctgtcccttcagatggagatcttgacagagctgggcttgcacttccgggtcctggatatgcccacccaagaactgggcctccccgcctaccgcaagtttgacattgaggcctggatgccaggccgaggccgctttggagaggtcaccagtgcttccaactgcacagacttccagagccgccgcctccacatcatgttccagaccgaggctggggagctgcagtttgcccatacggtgaacgccaccgcctgtgctgtcccccgccttctcatcgcgctcctggagagtaaccagcagaaggacggctcagtgctcgtgccccctgccctccagtcctacctcggcactgatcggatcacagcccctacccacgtgcctctccagtacatcggccccaaccagccccggaagcctgggctgcctggccagcctgctgtaagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 62
- chromosome 15 open reading frame 49
- transmembrane 4 L six family member 5
- immunoglobulin superfamily, member 10

Buy SARS2-seryl-tRNA synthetase 2, mitochondrial Gene now

Add to cart